The priority rule for constructing MST was set in order that the type that had the highest number of single-locus variants (SLVs) would be linked first. A cutoff value of maximum differences of 2 VNTRs out of 10 was applied selleck screening library to define cluster in the MST method. Results Selection of VNTR markers The use of the Tandem Repeat Finder software allowed the detection of 77 tandem repeats with a repeat unit larger than 9 bp. Putative VNTR markers were found in the 8 chromosomes of A. fumigatus. For the selection of

markers, 2 criteria were used: a homology of more than 90% between the different repeats and a number of repeats higher than 3. Only 10 out of these markers were polymorphic in the ROCK inhibitor 57 unrelated isolates. The 10 markers were located on 4 different

chromosomes (1, 5, 6 and 8). Five VNTRs were on PHA-848125 chromosome 1 (Asp_167, Asp_202, Asp_330, Asp_443 and Asp_446). VNTRs Asp_165, Asp_252 and Asp_345 were on chromosome 5. VNTRs Asp_204 and Asp_20 were on chromosome 6 and 8, respectively. Characteristics of final VNTRs and respective primer sets are listed in Table 2. Considering that the genome of A. fumigatus is haploid, we excluded isolates presenting double-bands patterns, because these patterns could be explained by a mixture of genotypes. When mixtures were suspected, different colonies were separated and subcultured. Each colony genotype was characterized by a distinct MLVA pattern (data not shown). This result proved that double-bands patterns were due to mixtures of isolates. Stability and reproducibility The 60 samples (5 isolates subcultured 12 times stiripentol in 2 months) used for the evaluation of stability were typed by MLVA and yielded exactly the same MLVA pattern. The 16 samples used for the evaluation of reproducibility (8 isolates tested by 2 different technicians in 2 different laboratories) yielded exactly the same MLVA pattern. Discriminatory power Simpson diversity index was first calculated for each VNTR and for the panel of 10 markers tested on the 57 unrelated isolates. The index for individual markers ranged from 0.5771 to 0.8530 (Table 3). A combined

loci index calculated with all of 10 markers yielded an index of 0.9994. When the VNTR profiles of 330 isolates were considered, the combined loci index was 0.9956. Table 3 Characteristics of VNTR markers for fingerprinting of Aspergillus fumigatus VNTR markers Primer sequences (5′ to 3′) Tm (°C) Unit repeat size (bp) Range of repeat number Simpson diversity index* Marker location (non coding region or name of gene if coding) Asp 167 TGAGATGGTTAACTTACGTAGCGC CGCTCCCACCGTTACCAAC 59 12 4-8 0.7151 Chromosome 1 (GPI anchored serine-rich protein) Asp 202 AGGATCACTGCCCTCAACCC CCGAAATCCGCGGGA 59 12 6-14 0.8530 Chromosome 1 (c-24(28) sterol reductase) Asp 330 ATCTGGTCGCGAAATTCCTCT TCTTCGGCCTTTTCATCCC 58 11 2-8 0.

Arch Oral Biol 1990,35(9):689–695.PubMedCrossRef 7. Shibata Y, Hiratsuka K, Hayakawa M, Shiroza T, Takiguchi H, Nagatsuka Y, Abiko Y: A 35-kDa co-aggregation factor is

a hemin binding protein in Porphyromonas gingivalis . Biochem Biophys Res Commun 2003,300(2):351–356.PubMedCrossRef 8. Seers CA, Slakeski N, Veith PD, Nikolof T, Chen YY, Dashper SG, Reynolds EC: The RgpB C-terminal domain has a role in attachment of RgpB to the outer membrane and belongs to a novel C-terminal-domain family found in Porphyromonas gingivalis . J Bacteriol 2006,188(17):6376–6386.PubMedCrossRef 9. Veith PD, Talbo GH, Slakeski N, Dashper SG, Moore C, Paolini RA, Reynolds EC: Major outer membrane Entospletinib mw proteins and proteolytic processing of RgpA and Kgp of Porphyromonas gingivalis W50. Biochem

J 2002,363(Pt 1):105–115.PubMedCrossRef 10. Curtis MA, Thickett A, Slaney JM, Rangarajan M, Aduse-Opoku J, Shepherd P, Paramonov N, Hounsell EF: Variable carbohydrate selleck products modifications to the catalytic chains of the RgpA and RgpB proteases of Porphyromonas gingivalis W50. Infect Immun 1999,67(8):3816–3823.PubMed 11. Nguyen KA, Travis J, Potempa J: Does the importance of the C-terminal residues in the maturation of RgpB from Porphyromonas gingivalis reveal a novel mechanism for protein export in a subgroup of Gram-negative bacteria? J Bacteriol 2007,189(3):833–843.PubMedCrossRef 12. Shiroza T, Okano S, Shibata click here Y, Hayakawa M, Fujita K, Yamaguchi K, Abiko Y: Functional analysis

of the thioredoxin domain in Porphyromonas gingivalis HBP35. Biosci Biotechnol Biochem 2008,72(7):1826–1835.PubMedCrossRef selleck kinase inhibitor 13. Debarbieux L, Beckwith J: The reductive enzyme thioredoxin 1 acts as an oxidant when it is exported to the Escherichia coli periplasm. Proc Natl Acad Sci USA 1998,95(18):10751–10756.PubMedCrossRef 14. Holmgren A: Thioredoxin catalyzes the reduction of insulin disulfides by dithiothreitol and dihydrolipoamide. J Biol Chem 1979,254(19):9627–9632.PubMed 15. Rangarajan M, Aduse-Opoku J, Paramonov N, Hashim A, Bostanci N, Fraser OP, Tarelli E, Curtis MA: Identification of a second lipopolysaccharide in Porphyromonas gingivalis W50. J Bacteriol 2008,190(8):2920–2932.PubMedCrossRef 16. Saito S, Hiratsuka K, Hayakawa M, Takiguchi H, Abiko Y: Inhibition of a Porphyromonas gingivalis colonizing factor between Actinomyces viscosus ATCC 19246 by monoclonal antibodies against recombinant 40 kDa outer-membrane protein. Gen Pharmac 1997,28(5):675–680. 17. Smalley JW, Birss AJ: Iron protoporphyrin IX-albumin complexing increases the capacity and avidity of its binding to the periodontopathogen Porphyromonas gingivalis . Microb Pathog 1999,26(3):131–137.PubMedCrossRef 18. Slakeski N, Dashper SG, Cook P, Poon C, Moore C, Reynolds EC: A Porphyromonas gingivalis genetic locus encoding a heme transport system. Oral Microbiol Immunol 2000,15(6):388–392.PubMedCrossRef 19.

I. – L’induction par conjugaison ou induction zygotique. Annales de l’Institut Pasteur 1956, 91:486–510.PubMed 33. Bertani LE, Bertani G: Genetics of P2 and related phages. Advances in Genetics 1971, 16:199–237.PubMedCrossRef 34. Portelli R, Dodd IB,

Xue Q, Egan JB: The late-expressed region of AZD0530 in vivo the temperate coliphage 186 genome. Virology 1998, 248:117–130.PubMedCrossRef 35. Nilsson AS, Haggård-Ljungquist E: The P2-like bacteriophages. The Bacteriophages Second Edition (Edited by: Calendar R). New York: Oxford University Press 2006, 365–390. 36. Esposito D, Fitzmaurice WP, Benjamin RC, Goodman SD, Scocca JJ: The complete nucleotide sequence of bacteriophage HP1 DNA. Nucleic Acids Research 1996, 24:2360–2368.PubMedCrossRef 37. Nakayama K, Kanaya S, Ohnishi M, Terawaki Y, Hayashi T: The complete nucleotide sequence of fCTX, a cytotoxin-converting phage of Pseudomonas HSP inhibitor aeruginosa : implications for phage evolution and horizontal gene transfer via bacteriophages. Molecular Microbiology Birinapant manufacturer 1999, 31:399–419.PubMedCrossRef 38. Kapfhammer D, Blass J, Evers S, Reidl J:Vibrio cholerae phage K139: complete genome sequence and comparative genomics

of related phages. Journal of Bacteriology 2002, 184:6592–6601.PubMedCrossRef 39. Campoy S, Aranda J, Alvarez G, Barbe J, Llagostera M: Isolation and sequencing of a temperate transducing phage for Pasteurella multocida. Applied & Environmental Microbiology SPTLC1 2006, 72:3154–3160.CrossRef 40. Beilstein F, Dreiseikelmann B: Temperate bacteriophage FO18P from an Aeromonas media isolate: characterization and complete genome sequence. Virology 2008, 373:25–29.PubMedCrossRef 41. Chibani-Chennoufi S, Dillmann ML, Marvin-Guy L, Rami-Shojaei S, Brüssow H:Lactobacillus plantarum bacteriophage LP65: a new member of the SPO1-like genus of the family Myoviridae. Journal of Bacteriology 2004, 186:7069–7083.PubMedCrossRef 42. Uchiyama J, Rashel M, Maeda

Y, Takemura I, Sugihara S, Akechi K, Muraoka A, Wakiguchi H, Matsuzaki S: Isolation and characterization of a novel Enterococcus faecalis bacteriophage fEF24C as a therapeutic candidate. FEMS Microbiology Letters 2008, 278:200–206.PubMedCrossRef 43. Uchiyama J, Rashel M, Takemura I, Wakiguchi H, Matsuzaki S: In silico and in vivo evaluation of bacteriophage fEF24C, a candidate for treatment of Enterococcus faecalis infections. Applied & Environmental Microbiology 2008, 74:4149–4163.CrossRef 44. Klumpp J, Dorscht J, Lurz R, Bielmann R, Wieland M, Zimmer M, Calendar R, Loessner MJ: The terminally redundant, nonpermuted genome of Listeria bacteriophage A511: a model for the SPO1-like myoviruses of gram-positive bacteria. Journal of Bacteriology 2008, 190:5753–5765.PubMedCrossRef 45. Allan BJ, Davies P, Carstens EB, Kropinski AM: Characterization of the genome of Pseudomonas aeruginosa bacteriophage phi PLS27 with particular reference to the ends of the DNA. Journal of Virology 1989, 63:1587–1594.PubMed 46.