MK-8353 | Inhibitor Kit

S100A12 promotes inﬂammation and apoptosis in ischemia/reperfusion injury via ERK signaling in vitro study using PC12 cells

Xiang Zhang | Rui Shen | Zhongwen Shu | Quanbin Zhang | Zuoquan Chen

Department of Neurosurgery, Shanghai Tenth People’s Hospital, Tongji University, Shanghai, China
Abbreviations:
ASC, apoptosis‐associated speck‐like protein containing a caspase recruitment domain; BBB, blood‐brain barrier; CAAF1s, calcium‐binding protein in amniotic ﬂuid‐1; EN‐RAGE, extracellular newly identiﬁed receptor for advanced glycation end products; I/R, ischemia/ reperfusion; NLRP3, NOD‐like receptor family, pyrin domain‐containing 3; OGD/R, oxygen‐glucose deprivation and reperfusion

Correspondence

Quanbin Zhang, MD and Zuoquan Chen, MM, Shanghai Tenth People’s Hospital, No. 301 Yanchang Road, Shanghai 200072, China.
Email: [email protected] and [email protected]

Funding information
Scientiﬁc Research Project of Shanghai Science and Technology Commission, Grant/Award Number: 17411967100

INTRODUCTION

Stroke, especially cerebral ischemia, is a destructive cer- ebrovascular accident that has become the major cause of mortality and morbidity around the world.1 Strokes most commonly originate from ischemia, which is caused by vessel occlusion in the cerebral circulation. Ischemic stroke

can be reversed by removing the obstruction and restoring blood ﬂow if diagnosed in a timely manner.2 However, reperfusion, but not ischemia itself, may result in additional, substantial brain damage called ‘ischemia/reperfusion (I/R)
injury’.3 Until now, massive efforts have been devoted to
ﬁnd neuroprotective agents that target pathological mecha- nisms of I/R injury, including inﬂammation, apoptosis, and

Pathology International. 2020;1–10. wileyonlinelibrary.com/journal/pin © 2020 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd | 1
blood‐brain barrier (BBB) disruption, and considerable ach- ievements have been reported in both in vitro and in vivo models of cerebral I/R injury.4,5 Nevertheless, due to the
limitations of these candidates, safe and effective ther- apeutic agents for cerebral I/R still need to be developed.6
It is well‐established that multiple pathological processes
are implicated in I/R injury.3,7,8 Reactive oxygen species (ROS) are widely believed to be the major cause of reperfusion‐induced damage to microvessels and paren-
chymal organs in ischemic tissue. After the restoration of
blood supply in ischemic tissue, excessive free radicals will attack the cells of this tissue and cause damage, namely ‘tissue ischemia/reperfusion injury’.9 I/R is also associated
with a pathological activation of the immunity and in-
ﬂammation. Tissue ischemia can result in toll‐like receptors (TLR)‐dependent induction of proinﬂammatory cytokines in- cluding tumor necrosis factor α (TNFα), interleukin (IL)‐1β and IL‐18.10 TLR expression can be increased by ROS, and production of the anti‐inﬂammatory cytokine IL‐10 will con- tribute to decreased levels of TNFα and ROS.11 In addition, I/R leads to the activation of cell death programs including
apoptosis, autophagy and necrosis. Increasing evidence has demonstrated the existence of excessive proinﬂammatory factors, proapoptotic proteins and oxidative stress products in cerebral I/R injury.5,8,12 Therefore, targeting inﬂammation and apoptosis could be a prospective therapy for treating
cerebral I/R injury.
The S100A12, also named calcium‐binding protein in amniotic ﬂuid‐1 (CAAF1s), calgranulin C or extracellular newly identiﬁed receptor for advanced glycation end prod- ucts (EN‐RAGE), is a member of the S100 proteins, which are small, acidic, calcium‐binding proteins with ‘EF‐hand type’ conformation and comprise more than 20 low‐ molecular‐weight protein members. It is well‐known that RAGE can promote inﬂammation by activation of non‐
glycation products. As a ligand of RAGE, the S100 family was found to be involved in inﬂammatory responses, in which S100A8, S100A9 and S100A12 have been conﬁrmed to play an important role in aggravating inﬂammation.13 Recently, it has been reported that S100A12 treatment sig- niﬁcantly increased the levels of inﬂammasome NOD‐like receptor family, pyrin domain‐containing 3 (NLRP3), apoptosis‐associated speck‐like protein containing a cas-
pase recruitment domain (ASC), caspase‐1, and proin-
ﬂammatory cytokines IL‐1β, IL‐18.14 Besides, serum
S100A12 was indicated to be a prognostic biomarker of severe traumatic brain injury.15 Also, in acute ischemic stroke, high plasma S100A12 levels are associated with a poor functional outcome.16 The preceding data suggested the potential prognostic role of S100A2 in I/R. However, whether S100A2 could contribute to the development of cerebral I/R injury and the underlying mechanism remains to be elucidated.

Furthermore, the RAS–RAF–MEK–ERK pathway (ERK sig- naling) is an evolutionary conserved signaling cascade that
transmits signals from cell surface receptors to promote cell proliferation and survival.17 It has been conﬁrmed that the ERK pathway is associated with inﬂammation, and blocking it could
inhibit release of inﬂammatory cytokines.17,18 Meanwhile, some studies have shown that S100A12‐induced damage was
mediated by the activation of ERK1/2 signaling, and blocking the ERK signaling could inhibit S100A12‐induced apoptosis and inﬂammatory response.19–21
PC12 cells, which derived from rat adrenal pheochromo- cytoma, can differentiate into neuron phenotype cells under the treatment of nerve growth factor (NGF), thereby exerting characteristics of neuronal cells in morphology, physiology and biochemistry.22 Therefore, PC12 has been a commonly used cell model for studying neurological diseases. Taken together, the purpose of this study was to investigate the role of S100A12 in I/R injury and determine whether the effect of S100A12 is dependent on ERK signaling in PC12 cells.
MATERIALS AND METHODS

Regents and antibodies

The ERK inhibitor MK‐8353 (SCH900353) was purchased from Selleck (Houston, TX, USA), Dulbecco’s modiﬁed eagle
medium (DMEM) and fetal bovine serum (FBS) were ob- tained from Gibco (Grand Island, NY, USA). S100A12 knockdown and overexpression vectors were constructed by Genscript Biotechnology (Nanjing, China). Enzyme‐linked
immunosorbent assay kits were obtained from Abcam
Biotechnology (Cambridge, UK). Reactive oxygen species (ROS), lipid peroxidation (MDA), lactate dehydrogenase (LDH) and superoxide dismutase (SOD) Activity Assay kit were purchased from Nanjing Jiancheng Bioengineering (Nanjing, China). The primary antibodies were as follows:
anti‐ERK1, anti‐ERK2, anti‐p‐ERK1/2, anti‐NLRP3, anti‐ ASC, anti‐caspase1, anti‐eNOS, anti‐p‐eNOS, anti‐Bcl‐2, anti‐Bax, anti‐cleaved caspase3, anti‐cleaved caspase9 and anti‐GAPDH were obtained from Santa Cruz Biotechnology (Dallas, TX, USA).
Cell culture

PC12 cells were obtained from American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in DMEM medium supplemented with 10% FBS and 1% anti- biotics, in a 5% CO2 humidiﬁed atmosphere at 37℃. After
treatment with 100 ng/mL nerve growth factor (NGF) for
about 5 days, PC12 cells that had differentiated were utilized for the next experiments (Fig. S1).
Oxygen‐glucose deprivation and reperfusion (OGD/R)

For simulation of an in vitro cerebral ischemia/reperfusion injury model, the OGD/R process was performed based on the method described previously.23 Brieﬂy, PC12 cells were cul-
tured in a deoxygenated glucose‐free Hanks’ balanced salt
solution inside an anaerobic chamber, which contains 5% CO2 and 95% N2, for 2 h. Then cells were removed from the anaerobic environment and transferred to normal conditions for 12 h. Cells that were not exposed to OGD and incubated under normal conditions were used as control groups.
Cell transfection

Recombinant S100A12 shRNA (target sequence: CCGGGTCGACTTTCAAGAATT‐CATACTCGAGTATGAATTC
TTGAAAGTCGACTTTTTG) or full‐length S100A12 cDNA was
cloned into the pcDNA3 vector, and the empty vector was used as a negative control. PC12 cells were seeded in 24‐well plates and cultured to 70–80% density, then transfected with indicated expressing vectors using Lipofectamine 2000 (Invitrogen,
Waltham, MA, USA) according to the manufacturer’s instruction.
Western blot analysis

For total proteins extraction, PC12 were washed twice with PBS and lysed using RIPA buffer (Beyotime, Shanghai, China). After centrifugation and quantiﬁcation, each sample was
separated by sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS‐PAGE), and then transferred onto poly- vinylidene ﬂuoride (PVDF) membranes (Bio‐Rad, Hercules, CA, USA). After being blocked using nonfat milk at room

temperature for 1 h, the membranes were incubated with primary antibodies against ERK1, ERK2, p‐ERK1, p‐ERK2, NLRP3, ASC, caspase1, eNOS, p‐eNOS, Bcl‐2, Bax, cleaved‐ caspase3 and cleaved‐caspase9 at 4ºC overnight. Anti‐ GAPDH antibody was selected as internal reference. Next, the membranes were washed with Tris‐buffered saline and incubated with horseradish peroxidase (HRP)‐conjugated secondary antibodies at room temperature for 2 h. Finally,
the membranes were visualized by the ECL (electro- chemiluminescence) system (Amersham, Chicago, IL, USA).

Real‐time quantitative polymerase chain reaction (RT‐qPCR)

For detection of the messenger RNA (mRNA) level, total RNA of PC12 cells was extracted using TRIzol reagent (Invitrogen). Then agarose gel electrophoresis and ultra- violet spectrophotometry were applied to determine RNA concentration and purity. Total RNA was converted to cDNA using the PrimeScriptTM RT reagent kit with gDNA Eraser
(Takara Biotechnology, Beijing, China). RT‐qPCR was per- formed with SYBR Green (Invitrogen) in a Bio‐Rad real‐time
PCR detection system. Primers were as follows: S100A12, forward 5′‐ATTCCTGTGCATTGAGGGGTTA‐3′, reverse 5′‐TGTCAAAATGCCCCTTCCGA‐3′.

Detection of inﬂammatory and oxidative markers

The levels of proinﬂammatory cytokines TNF‐α, IL‐1β, IL‐18 and IL‐10 in the culture medium of PC12 cells were detected
using ELISA kit following the manufacturer’s instructions. Cellular ROS assay kit, MDA Assay kit, LDH and SOD

Figure 1 S100A12 messenger RNA (mRNA) was upregulated after oxygen‐glucose deprivation and reperfusion (OGD/R). (a) Relative mRNA expression of S100A12 in control and OGD/R‐treated PC12 cells (n = 3). **P < 0.01 versus control. (b) Relative mRNA expression of S100A12 before and after S100A12 was knockdown (n = 3). short hairpin RNA (ShRNA), shRNA‐S100A12‐1 and shRNA‐S100A12‐2 indicate the cells were transfected with empty plasmids, shRNA‐S100A12‐1 and shRNA‐S100A12‐2, respectively. ***P < 0.001 versus shRNA group.

(c) Relative mRNA expression of S100A12 before and after S100A12 was overexpressed (n = 3). Ov‐NC means overexpression negative control. Ov‐S100A12 means overexpression of S100A12. ***P < 0.001 versus Ov‐NC group.

Figure 2 Effects of S100A12 on ERK1/2 protein expression. (a, b) Representative immunoblot analysis and quantiﬁcation for p‐ERK1/ERK1 and p‐ERK2/ERK2 in different groups (n = 3). Oxygen‐glucose deprivation and reperfusion (OGD/R) means oxygen‐glucose deprivation and reperfusion. Ov means overexpression. ***P < 0.001 versus control. #P < 0.05 and ##P < 0.01 versus OGD/R + shRNA. ΔP < 0.05 and Δ ΔP < 0.01 versus OGD/R + Ov‐NC.
Activity Assay were used to determine the generation of ROS, MDA, LDH and SOD.

Flow cytometry

Cell apoptosis was assessed by ﬂow cytometry using propidium iodide (PI) staining. Brieﬂy, cells were gently washed twice with PBS, digested with 0.25% trypsin, and
centrifuged at 200g for 5 min. After gently resuspension of the cell pellet with 1 mL NaCl/Pi, cells were incubated in PI for 15 min in a darkroom and immediately analyzed by ﬂow
cytometer (Becton Dickinson, USA). Data were analyzed by
ﬂow cytometry software.

Statistical analysis

All results were expressed as mean ± standard deviation, the statistical analyses were performed using the GraphPad
Prism 6 (La Jolla, CA, USA). Differences between the data

were tested using Student’s t‐test and one‐way analysis of variance. P < 0.05 was considered statistically signiﬁcant.
RESULTS

S100A12 was upregulated after cerebral I/R in PC12 cells

To determine whether S100A12 was involved in cerebral I/R, the mRNA level of S100A12 in PC12 cells was detected ﬁrst. As shown in Fig. 1a, expression of S100A12 mRNA was signiﬁcantly upregulated in the OGD/R group. The mRNA alteration of S100A12 after OGD/R treatment indicated a role of it in cerebral I/R injury. Next, to conﬁrm the detailed functions of S100A12 in cerebral I/R injury, we constructed
two short hairpin RNA (shRNA) expression vectors, shRNA‐S100A12‐1 and shRNA‐S100A12‐2, to knockdown the expression of S100A12. Results showed a better knockdown effect of shRNA‐S100A12‐1, so we chose
shRNA‐S100A12‐1 for the following study (Fig. 1b). One

Figure 3 Effects of S100A12 on generation of inﬂammatory cytokines. The activities of tumor necrosis factor α (TNF‐α) (a), interleukin (IL)‐1β (b), IL‐18 (c) and IL‐10 (d) in different groups (n = 3). Oxygen‐glucose deprivation and reperfusion (OGD/R) means oxygen‐glucose deprivation and reperfusion. Ov means overexpression. OGD/R means oxygen‐glucose deprivation and reperfusion. Ov means overexpression. *P < 0.05, **P < 0.01 and ***P < 0.001 versus OGD/R. #P < 0.05 and ##P < 0.01 versus OGD/R + Ov‐S100A12.
full‐length S100A12 vector was transfected into PC12 cells to overexpress S100A12, the efﬁciency of S100A12 overexpression was conﬁrmed by RT‐qPCR (Fig. 1c).
S100A12 regulated the expression of ERK1/2 proteins

Considering the previous evidence that the proin- ﬂammatory effect of S100A12 is mediated by ERK sig- naling, western blot analysis was used to detect ERK1
and ERK2 protein expression with or without S100A12 knockdown and overexpression. The empty expressing vectors were used as negative control. Results revealed that the relative expression of activated ERK1 and ERK2 was markedly enhanced by OGD/R treatment and re- covered after S100A12 knockdown, but further increased by S100A12 overexpression (Fig. 2). These data sug- gested the stimulative effect of S100A12 on ERK

signaling. At the same time, we can conclude that the negative controls of S100A12 knockdown and over- expression have no additional effect on ERK1/2 protein expression, so these two negative control groups will be excluded in the next study.
Effect of S100A12 on OGD/R‐induced inﬂammation

To identify whether S100A12 could mediate inﬂammation in cerebral I/R injury, PC12 cells transfected with or without S100A12 knockdown and overexpression vectors were ex- posed to OGD/R, and the levels of inﬂammatory cytokines
and the protein expression of inﬂammasome were assessed.
Results showed that silencing of S100A12 was blunted, while overexpression of S100A12 aggravated the OGD/R‐ induced release of proinﬂammatory factors TNFα, IL‐1β and
IL‐18 together with decrease of anti‐inﬂammatory IL‐10.

Figure 4 Effects of S100A12 on protein expression of inﬂammasome. Representative immunoblot analysis (a) and quantiﬁcation for NOD‐like receptor family, pyrin domain‐containing 3 (NLRP3) (b), apoptosis‐associated speck‐like protein containing a caspase recruitment domain (ASC) (c) and Caspase1 (d) in different groups (n = 3). Oxygen‐glucose deprivation and reperfusion (OGD/R) means oxygen‐glucose deprivation and reperfusion. Ov means overexpression. OGD/R means oxygen‐glucose deprivation and reperfusion. Ov means overexpression. *P < 0.05, **P < 0.01 and ***P < 0.001 versus OGD/R. #P < 0.05 and ##P < 0.01 versus OGD/R + Ov‐S100A12.
In addition, the selective ERK1/2 inhibitor MK‐8353 was applied to further determine the ERK‐dependent effect of S100A12. As shown in Fig. 3, the presence of MK‐8353 abolished the proinﬂammatory effect of S100A12 after OGD/R treatment. Similarly, silencing or overexpression of
S100A12 and treatment with MK‐8353 exerted the same effect on OGD/R‐enhanced protein expression NLRP3, ASC and caspase1, respectively (Fig. 4). These results indicated the incentive effect of S100A12 on inﬂammation in cerebral I/R, which is mediated by ERK pathway.
Effect of S100A12 on oxidative stress

To observe the inﬂuence of S100A12 on oxidative stress, the activities of ROS, MDA, LDH and SOD were eval-
uated. Results revealed that OGD/R brought about the

excitation of oxidative products ROS, MAD and LDH, while cut down the activity of antioxidase SOD. However, these effects were blunted by S100A12 si- lencing and restored by its’ overexpression, and MK‐8353
counteracted the effect of S100A12 overexpression
(Fig. 5a–d).
Endothelial nitric oxide synthase (eNOS) is reported to be involved in vascular oxidative stress, and its product NO exerts neuroprotective effects.24 We utilized western blot analysis to investigate the alteration of eNOS expression. Results suggested that the expression of eNOS was ob- viously reduced after OGD/R, S100A12 silencing rescued, while S100A12 overexpression weakened eNOS protein
expression. At the same time, MK‐8353 abrogated the effect
of S100A12 overexpression, suggesting the accelerative effect of S100A12 on I/R‐induced oxidative stress via ERK signaling (Fig. 5e).

Figure 5 Effects of S100A12 on oxidative stress. (a–d) Relative expression of reactive oxygen species (ROS) (a), lipid peroxidation (MDA) (b), lactate dehydrogenase (LDH) (c) and superoxide dismutase (SOD) (d). (e) Representative immunoblot analysis and quantiﬁcation for p‐endothelial nitric oxide synthase (eNOS)/eNOS in different groups. Oxygen‐glucose deprivation and reperfusion (OGD/R) means oxygen‐ glucose deprivation and reperfusion. Ov means overexpression. OGD/R means oxygen‐glucose deprivation and reperfusion. Ov means overexpression. *P < 0.05, **P < 0.01 and ***P < 0.001 versus OGD/R. #P < 0.05, ##P < 0.01 and ###P < 0.001 versus OGD/R + Ov‐S100A12.
Effect of S100A12 on OGD/R‐induced apoptosis

To examine the role of S100A12 in OGD/R‐induced cell apop- tosis, we detected the ratio of apoptotic cells and the expression of apoptosis‐related proteins. As demonstrated in Fig. 6, com- pared with OGD/R groups, shRNA‐ S100A12 attenuated, while overexpression‐S100A12 restored the OGD/R‐induced increase of cell apoptosis rate.
As shown in Fig. 7, the expression of antiapoptotic protein Bcl‐2 was decreased, but the expression of proapoptotic pro- teins Bax, cleved‐caspase3 and ‐caspase9 was enhanced after OGD/R treatment. Meanwhile, all these effects were blunted by
S100A12 knockdown, while rescued by S100A12 over- expression. The enhanced effect of S100A12 overexpression on cell apoptosis was also reversed by ERK inhibitor MK‐8353.
These data revealed that S100A12 play an aggravating function
in OGD/R‐produced apoptosis via ERK signaling.

DISCUSSION

The present study is the ﬁrst to shed light on the effects of S100A12 on I/R injury. Here, we conﬁrmed that S100A12 pro- motes OGD/R‐induced inﬂammation, oxidative stress and cell apoptosis in PC12 cells via activating the ERK signaling
pathway.
Cerebral I/R injury is the most common complication in stroke patients undergoing thrombolytic therapy. The spe- ciﬁc mechanism of cerebral I/R injury is poorly understood,25 therefore, uncovering the potential mechanism of cerebral
I/R injury and developing effective agents for treating it are of great clinical importance.
S100A12 is a member of the S100 proteins, which have been reported to be involved in inﬂammatory response. Increasing evidence has suggested the proinﬂammatory
effect of S100A12 in inﬂammation‐related diseases.14,26,27

Figure 6 Effects of S100A12 on apoptosis rate. (a) Cell apoptosis was assessed by ﬂow cytometry. (b) Quantiﬁcation of apoptosis rate in different groups. Oxygen‐glucose deprivation and reperfusion (OGD/R) means oxygen‐glucose deprivation and reperfusion. Ov means overexpression. OGD/R means oxygen‐glucose deprivation and reperfusion. Ov means overexpression. **P < 0.01 and ***P < 0.001 versus OGD/R. ###P < 0.001 versus OGD/R + Ov‐S100A12.

Associated with previous studies,15,16 we found that the level of S100A12 mRNA was signiﬁcantly upregulated in the I/R injury in vitro model (Fig. 1a), suggesting the possible role
of S100A12 in I/R injury. To further investigate the effects of S100A12 in I/R injury, we knocked down and overexpressed S100A12 in PC12 cells to observe the protein expression of ERK1 and ERK2. Results indicated that the expression of activated ERK1 and ERK2 proteins was obviously increased
after OGD/R (Fig. 2). These data are consistent with others’
ﬁndings that the ERK pathway would be activated in re-
sponse to I/R injury.28,29 Also, S100A12 silencing blunted, while its’ overexpression enhanced the OGD/R‐induced ac- tivation of ERK1/2 (Fig. 2). This result can be explained by previous studies which inferred that S100A12‐induced damage would be dependent on activation of ERK1/2 sig- naling.19–21 Based on these ﬁndings, we speculated that

S100A12 could aggravate OGD/R‐induced injury in PC12 cells through activating ERK signaling.
It is widely accepted that inﬂammation and oxidative stress play a pivotal role in the pathogenesis of I/R injury because of the overproduction of proinﬂammatory cytokines and free oxygen radicals, leading to extensive cell apoptosis and death.30 We next examined the alteration of OGD/R‐induced in-
ﬂammation, oxidative stress and cell apoptosis. Our results
showed that following OGD/R treatment, the generation of proinﬂammatory factors TNFα, IL‐1β and IL‐18; the level of in- ﬂammasome NLRP3, ASC and caspase1; the activities of oxi-
dative products ROS, MDA and LDH; the ratio of cell apoptosis; the expression of proapoptotic proteins Bax, caspase3 and caspase9 were signiﬁcantly increased. On the contrary, the
generation of anti‐inﬂammatory factors IL‐10; the level of anti-
oxidase SOD and eNOS; the expression of antiapoptotic protein

Figure 7 Effects of S100A12 on expression of apoptotic proteins. (a) Representative immunoblot analysis and quantiﬁcation for Bcl‐2 and Bax in different groups. (b) Representative immunoblot analysis and quantiﬁcation for cleaved‐caspase3 and cleaved‐caspase9 in different groups. Oxygen‐glucose deprivation and reperfusion (OGD/R) means oxygen‐glucose deprivation and reperfusion. Ov means over- expression. OGD/R means oxygen‐glucose deprivation and reperfusion. Ov means overexpression. *P < 0.05, **P < 0.01 and ***P < 0.001 versus OGD/R. ##P < 0.01 versus OGD/R + Ov‐S100A12.
Bcl‐2 were obviously decreased. Brieﬂy, OGD/R produced the occurrence of inﬂammation, oxidative stress and apoptosis in PC12 cells. However, all these effects were cut down by
S100A12 silencing and exacerbated by its overexpression, conﬁrming the promoting effect of S100A12 on cerebral I/R injury.
Furthermore, we incubated cells that were transfected into S100A12‐overexpressed plasmids with ERK1/2 inhibitor MK‐ 8353 to observe the effect of ERK signaling on S100A12‐ enhanced I/R damage in brain, simultaneously. The results that
MK‐8353 partially abolished the enhanced effects of S100A12 overexpression on the OGD/R‐induced inﬂammation, oxidative stress and apoptosis further conﬁrmed our hypothesis that S100A12 exerted its effects via activating the ERK pathway. However, the presence of MK‐8353 didn’t completely eliminate the functions of S100A12 overexpression when compared with
OGD/R groups, suggesting the existence of other pathways or receptors which are in charge of the signal transmission of

S100A12 besides ERK signaling. In addition, as a calcium‐ binding protein, S100A12 can activate and participate in a va- riety of signaling pathways including nuclear factor (NF)‐κB, mitogen actived protein kinas (MAPK) and ERK by binding to
Ca2+ such as calmodulin kinase II, protein kinase C (PKC) and phospholipase C (PLC).31,32 Therefore, multiple signaling may involve in the effect of S100A12 on I/R injury, more in vitro and in vivo research is still needed to be launched to reveal the detailed mechanism of S100A12 actions.
In conclusion, our results display a new role of S100A12 in mediating OGD/R‐induced inﬂammation, oxidative stress and apoptosis in PC12 cells. Considering the characteristics of PC12
is same with neuronal cells in morphology, physiology, and biochemistry, this study indicated that inhibiting S100A12 might be a prospective therapy for treating or preventing I/R in brain. Future investigation can be focused on developing S100A12
antagonist and investigating its MK-8353 curative effect in cerebral I/R as well as other inﬂammation‐related diseases.
ACKNOWLEDGMENT
This work was supported by the Scientiﬁc Research Project of Shanghai Science and Technology Commission under Grant no.17411967100.
DISCLOSURE STATEMENT

None declared.

AUTHOR CONTRIBUTIONS

QZ and ZC: conception and design of the study; XZ and RS: acquisition and analysis of data; ZS: drafting the manuscript or ﬁgures.

REFERENCES

1 Prabhakaran S, Ruff I, Bernstein RA. Acute stroke intervention: A systematic review. JAMA 2015; 313: 1451–62.
2 Benjamin EJ, Muntner P, Alonso A et al. Heart disease and
stroke statistics‐2019 update: A report from the American Heart Association. Circulation 2019; 139: e56–528.
3 Sanderson TH, Reynolds CA, Kumar R, Przyklenk K, Huttemann M. Molecular mechanisms of ischemia‐reperfusion injury in brain: Piv- otal role of the mitochondrial membrane potential in reactive oxygen species generation. Mol Neurobiol 2013; 47: 9–23.
4 Palomares SM, Cipolla MJ. Vascular protection following
cerebral ischemia and reperfusion. J Neurol Neurophysiol 2011;
2011: S1–004.
5 Majid A. Neuroprotection in stroke: Past, present, and future.
ISRN Neurol 2014; 2014: 515716.
6 Thompson BJ, Ronaldson PT. Drug delivery to the ischemic brain. Adv Pharmacol 2014; 71: 165–202.
7 Gong L, Tang Y, An R, Lin M, Chen L, Du J. RTN1‐C mediates cerebral ischemia/reperfusion injury via ER stress and mitochondria‐
associated apoptosis pathways. Cell Death Dis 2017; 8: e3080.
8 Zhang DD, Zou MJ, Zhang YT et al. A novel IL‐1RA‐PEP fusion protein with enhanced brain penetration ameliorates cerebral ischemia‐reperfusion injury by inhibition of oxidative stress and neuroinﬂammation. Exp Neurol 2017; 297: 1–13.
9 Parks DA, Granger DN. Ischemia‐reperfusion injury: A radical view. Hepatology 1988; 8: 680–82.
10 Eltzschig HK, Eckle T. Ischemia and reperfusion—from mechanism to translation. Nat Med 2011; 17: 1391–401.
11 Iadecola C, Anrather J. The immunology of stroke: From mechanisms to translation. Nat Med 2011; 17: 796–808.
12 Wu H, Tang C, Tai LW et al. Flurbiprofen axetil attenuates
cerebral ischemia/reperfusion injury by reducing inﬂammation in a rat model of transient global cerebral ischemia/reperfusion. Biosci Rep 2018; 38 https://doi.org/10.1042/BSR20171562
13 Pietzsch J, Hoppmann S. Human S100A12: A novel key player in inﬂammation? Amino Acids 2009; 36: 381–89.
14 Dong N, Wang Y. MiR‐30a regulates S100A12‐induced retinal microglial activation and inﬂammation by targeting NLRP3. Curr Eye Res 2019; 44: 1236–43.

15 Feng MJ, Ning WB, Wang W et al. Serum S100A12 as a prognostic biomarker of severe traumatic brain injury. Clin Chim Acta 2018; 480: 84–91.
16 Wakisaka Y, Ago T, Kamouchi M et al. Plasma S100A12 is asso-
ciated with functional outcome after ischemic stroke: Research for Biomarkers in Ischemic Stroke. J Neurol Sci 2014; 340: 75–79.
17 Samatar AA, Poulikakos PI. Targeting RAS‐ERK signalling in
cancer: Promises and challenges. Nat Rev Drug Discov 2014; 13: 928–42.
18 Yoo SR, Kim Y, Lee MY et al. Gyeji‐tang water extract
exerts anti‐inﬂammatory activity through inhibition of ERK and NF‐kappaB pathways in lipopolysaccharide‐stimulated RAW
264.7 cells. BMC Complement Altern Med 2016; 16: 390.
19 Wen X, Han XR, Wang YJ et al. Effects of S100A12 gene si- lencing on serum levels of anti‐inﬂammatory/pro‐inﬂammatory cytokines in septic rats through the ERK signaling pathway. J Cell Biochem 2018; 119: 4038–49.
20 Jiang W, Wang Z, Hu Z et al. Blocking the ERK1/2 signal
pathway can inhibit S100A12 induced human aortic smooth muscle cells damage. Cell Biol Int 2017; 41: 1307–15.
21 Chung YM, Goyette J, Tedla N, Hsu K, Geczy CL. S100A12
suppresses pro‐inﬂammatory, but not pro‐thrombotic functions of serum amyloid A. PLoS One 2013; 8: e62372.
22 Wigerius M, Asghar N, Melik W, Johansson M. Scribble controls NGF‐mediated neurite outgrowth in PC12 cells. Eur J Cell Biol 2013; 92: 213–21.
23 Domin H, Przykaza L, Jantas D, Kozniewska E, Boguszewski PM,
Smialowska M. Neuroprotective potential of the group III mGlu re- ceptor agonist ACPT‐I in animal models of ischemic stroke: In vitro and in vivo studies. Neuropharmacology 2016; 102: 276–94.
24 Li H, Horke S, Forstermann U. Vascular oxidative stress, nitric oxide and atherosclerosis. Atherosclerosis 2014; 237: 208–19.
25 Nagy Z, Nardai S. Cerebral ischemia/repefusion injury: From
bench space to bedside. Brain Res Bull 2017; 134: 30–37.
26 van de Logt F, Day AS. S100A12: A noninvasive marker of in- ﬂammation in inﬂammatory bowel disease. J Dig Dis 2013; 14: 62–67.
27 Meijer B, Gearry RB, Day AS. The role of S100A12 as a sys-
temic marker of inﬂammation. Int J Inﬂam 2012; 2012: 907078.
28 Zhou J, Du T, Li B, Rong Y, Verkhratsky A, Peng L. Crosstalk
between MAPK/ERK and PI3K/AKT signal pathways during brain ischemia/reperfusion. ASN Neuro 2015; 7 https://doi.org/ 10.1177/1759091415602463
29 Zhu BL, Xie CL, Hu NN, Zhu XB, Liu CF. Inhibiting of GRASP65 phosphorylation by DL‐3‐N‐butylphthalide protects against cer- ebral ischemia‐reperfusion injury via ERK signaling. Behav Neurol 2018; 2018: 5701719.
30 Pan J, Konstas AA, Bateman B, Ortolano GA, Pile‐Spellman J. Reperfusion injury following cerebral ischemia: Pathophysi-
ology, MR imaging, and potential therapies. Neuroradiology
2007; 49: 93–102.
31 Nazari A, Khorramdelazad H, Hassanshahi G et al. S100A12
in renal and cardiovascular diseases. Life Sci 2017; 191: 253–58.
32 Bagheri V. S100A12: Friend or foe in pulmonary tuberculosis?
Cytokine 2017; 92: 80–82.

SUPPORTING INFORMATION
Additional supporting information may be found online in the Supporting Information section.