The priority rule for constructing MST was set in order that the type that had the highest number of single-locus variants (SLVs) would be linked first. A cutoff value of maximum differences of 2 VNTRs out of 10 was applied selleck screening library to define cluster in the MST method. Results Selection of VNTR markers The use of the Tandem Repeat Finder software allowed the detection of 77 tandem repeats with a repeat unit larger than 9 bp. Putative VNTR markers were found in the 8 chromosomes of A. fumigatus. For the selection of

markers, 2 criteria were used: a homology of more than 90% between the different repeats and a number of repeats higher than 3. Only 10 out of these markers were polymorphic in the ROCK inhibitor 57 unrelated isolates. The 10 markers were located on 4 different

chromosomes (1, 5, 6 and 8). Five VNTRs were on PHA-848125 chromosome 1 (Asp_167, Asp_202, Asp_330, Asp_443 and Asp_446). VNTRs Asp_165, Asp_252 and Asp_345 were on chromosome 5. VNTRs Asp_204 and Asp_20 were on chromosome 6 and 8, respectively. Characteristics of final VNTRs and respective primer sets are listed in Table 2. Considering that the genome of A. fumigatus is haploid, we excluded isolates presenting double-bands patterns, because these patterns could be explained by a mixture of genotypes. When mixtures were suspected, different colonies were separated and subcultured. Each colony genotype was characterized by a distinct MLVA pattern (data not shown). This result proved that double-bands patterns were due to mixtures of isolates. Stability and reproducibility The 60 samples (5 isolates subcultured 12 times stiripentol in 2 months) used for the evaluation of stability were typed by MLVA and yielded exactly the same MLVA pattern. The 16 samples used for the evaluation of reproducibility (8 isolates tested by 2 different technicians in 2 different laboratories) yielded exactly the same MLVA pattern. Discriminatory power Simpson diversity index was first calculated for each VNTR and for the panel of 10 markers tested on the 57 unrelated isolates. The index for individual markers ranged from 0.5771 to 0.8530 (Table 3). A combined

loci index calculated with all of 10 markers yielded an index of 0.9994. When the VNTR profiles of 330 isolates were considered, the combined loci index was 0.9956. Table 3 Characteristics of VNTR markers for fingerprinting of Aspergillus fumigatus VNTR markers Primer sequences (5′ to 3′) Tm (°C) Unit repeat size (bp) Range of repeat number Simpson diversity index* Marker location (non coding region or name of gene if coding) Asp 167 TGAGATGGTTAACTTACGTAGCGC CGCTCCCACCGTTACCAAC 59 12 4-8 0.7151 Chromosome 1 (GPI anchored serine-rich protein) Asp 202 AGGATCACTGCCCTCAACCC CCGAAATCCGCGGGA 59 12 6-14 0.8530 Chromosome 1 (c-24(28) sterol reductase) Asp 330 ATCTGGTCGCGAAATTCCTCT TCTTCGGCCTTTTCATCCC 58 11 2-8 0.