With regards to ventilation, the majority of patients were able to breathe spontaneously (n = 452; 89.7%), but some were ventilated with pressure-controlled Gemcitabine ic50 ventilation (n =

49; 9.7%), synchronized intermittent mandatory ventilation (n = 2; 0.4%), or continuous positive airway pressure (n = 1; 0.2%). Regarding complications, one patient required endotracheal intubation (n = 1; 0.2%) and another experienced pulmonary embolism (n = 1; 0.2%), both during flying. Otherwise, transportation was tolerated well by the patients. The majority of journeys were carried out with an air ambulance (n = 391; 77.6%), but scheduled aircraft with regular seating (n = 62; 12.3%), a stretcher in a scheduled aircraft (n = 48; 9.6%), and a patient transport compartment (PTC), which is a medical transport facility offered on board scheduled Lufthansa aircrafts (n = 3; 0.6%), were also used. Sixteen different types of aircrafts were used in total; the top three were the Learjet 35 (n = 127; 25.2%), PA-42 400 (n = 97; 19.2%), and King Air 200 (n =

70; 13.9%). The majority of the flights were nonstop flights (n = 409; 81.2%). However, there were also some flights with one (n = 60; 11.9%), two (n = 23; 4.6%), OTX015 or three (n = 12, 2.4%) stopovers. The median flight distance was 1,655 km (IQR 858–22,637 km), with a median flight time of 180 min (IQR 115–255 min) and a median total of 370 min (IQR 256–525 min) including ground time. Different vehicles were used for transport from the destination airport to the final destination: regular ambulance (n = 266; 52.8%), emergency ambulance (n = 213; 42.3%), intensive care helicopter (n = 2; 0.4%), or intensive care ambulance (n = 1, 0.2%). The median distance from the airport to the final destination was 35 km (IQR 20–75 km). The top Acetophenone six countries of transport origin were Spain (n = 111; 22%), Turkey (n = 62; 12.3%), Italy (n = 35; 6.9%), Greece (n = 32; 6.4%),

Croatia (n = 16; 3.2%), and Poland (n = 15; 3%). Details on geographic data of transport origin are shown in Table 2. From a technical standpoint, the majority of cases were uneventful; nevertheless, there were a few specific minor problems (n = 8; 1.6%): the destination airport was changed during the flight in five cases due to changing weather conditions (n = 5; 1%), a pressure drop in the cabin (n = 1; 0.2%), and minor technical problems involving the landing gear (n = 2; 0.4%) were also documented. The costs per flight-minute and per kilometer were calculated for scheduled aircraft with regular seating to be 17.57 €/min and 1.74 €/km, for a stretcher in a scheduled aircraft 35.28 €/min and 3.29 €/km, and for an air ambulance 73.67 €/min and 7.49 €/km, respectively. The costs of the PTC cases were not evaluated because of the limited number of cases (n = 3; 0.6%). However, they have been previously described by Veldman and colleagues, who published data on PTC transport costs.

In an earlier study where 0.1% w/v sodium acetate was added, it was found that of a mixture of 40 μM VC, t-DCE, and TCE, ∼30% of the added VC and t-DCE were degraded after 216 h of incubation. Here, when Methylocystis strain SB2 was grown with 0.1% v/v ethanol and a mixture of 40 μM VC, t-DCE, and TCE, ∼13% and 12% of VC and t-DCE, respectively, were degraded after 120 h of incubation. Different time periods were used for ethanol- MK1775 and acetate-grown cultures to reflect the time of active growth, i.e., Methylocystis strain SB2 grown on ethanol entered the stationary phase of growth

more quickly that when grown on acetate. It may be that with a longer incubation time, ethanol-grown cultures of Methylocystis strain SB2 may have degraded more of these compounds. In summary, these data show that the competitive Staurosporine chemical structure inhibition of pMMO is a key factor in controlling the ability of methanotrophs to degrade a variety of chlorinated hydrocarbons. Given that via facultative methanotrophy, pollutant degradation is uncoupled from carbon assimilation, the addition of alternative substrates such as ethanol or acetate to promote methanotrophic-mediated pollutant degradation may be a useful strategy for enhanced bioremediation of polluted sites. It should be kept in mind, however, that both substrate and product toxicity of chlorinated hydrocarbons can limit the growth of methanotrophs regardless

of the growth substrate, and by extension, their ability to degrade these compounds. Future work should determine the abundance and distribution of facultative methanotrophs in situ, as well as the ability of facultative methanotrophs to compete for alternative substrates in the presence of heterotrophic microorganisms in more complex systems, for example, soil microcosms. Finally, more research is needed to consider how best to use facultative methanotrophic communities for pollutant degradation both in aboveground reactors and in situ. “
“A metagenomic approach was applied using 454-pyrosequencing data analysis for the profiling of bacterial communities in the

brine samples of the water reclamation plant. Some physicochemical eltoprazine characteristics of brine samples were also determined using standard methods. Samples ranged from being lightly alkaline to highly alkaline (pH 7.40–10.91) throughout the various treatment stages, with the salinity ranging from 1.62 to 4.53 g L−1 and dissolved oxygen concentrations ranging from 7.47 to 9.12 mg L−1. Phenotypic switching was found to occur due to these physicochemical parameters. Microbial diversities increased from those present in Stage I reactor (six taxonomic groups) to those in Reverse Osmosis (RO) stage I (17 taxonomic groups), whereas in the second phase of the treatment, it increased in Stage II clarifier (14 taxonomic groups) followed by a decrease in RO stage II (seven taxonomic groups). Overall, seven phyla were detected, apart from many bacterial sequences that were unclassified at the phylum level.

In an earlier study where 0.1% w/v sodium acetate was added, it was found that of a mixture of 40 μM VC, t-DCE, and TCE, ∼30% of the added VC and t-DCE were degraded after 216 h of incubation. Here, when Methylocystis strain SB2 was grown with 0.1% v/v ethanol and a mixture of 40 μM VC, t-DCE, and TCE, ∼13% and 12% of VC and t-DCE, respectively, were degraded after 120 h of incubation. Different time periods were used for ethanol- selleck kinase inhibitor and acetate-grown cultures to reflect the time of active growth, i.e., Methylocystis strain SB2 grown on ethanol entered the stationary phase of growth

more quickly that when grown on acetate. It may be that with a longer incubation time, ethanol-grown cultures of Methylocystis strain SB2 may have degraded more of these compounds. In summary, these data show that the competitive GSI-IX research buy inhibition of pMMO is a key factor in controlling the ability of methanotrophs to degrade a variety of chlorinated hydrocarbons. Given that via facultative methanotrophy, pollutant degradation is uncoupled from carbon assimilation, the addition of alternative substrates such as ethanol or acetate to promote methanotrophic-mediated pollutant degradation may be a useful strategy for enhanced bioremediation of polluted sites. It should be kept in mind, however, that both substrate and product toxicity of chlorinated hydrocarbons can limit the growth of methanotrophs regardless

of the growth substrate, and by extension, their ability to degrade these compounds. Future work should determine the abundance and distribution of facultative methanotrophs in situ, as well as the ability of facultative methanotrophs to compete for alternative substrates in the presence of heterotrophic microorganisms in more complex systems, for example, soil microcosms. Finally, more research is needed to consider how best to use facultative methanotrophic communities for pollutant degradation both in aboveground reactors and in situ. “
“A metagenomic approach was applied using 454-pyrosequencing data analysis for the profiling of bacterial communities in the

brine samples of the water reclamation plant. Some physicochemical tuclazepam characteristics of brine samples were also determined using standard methods. Samples ranged from being lightly alkaline to highly alkaline (pH 7.40–10.91) throughout the various treatment stages, with the salinity ranging from 1.62 to 4.53 g L−1 and dissolved oxygen concentrations ranging from 7.47 to 9.12 mg L−1. Phenotypic switching was found to occur due to these physicochemical parameters. Microbial diversities increased from those present in Stage I reactor (six taxonomic groups) to those in Reverse Osmosis (RO) stage I (17 taxonomic groups), whereas in the second phase of the treatment, it increased in Stage II clarifier (14 taxonomic groups) followed by a decrease in RO stage II (seven taxonomic groups). Overall, seven phyla were detected, apart from many bacterial sequences that were unclassified at the phylum level.

Although unlicensed in Europe, unboosted ATV is often used in clinical practice for several reasons. In our sample, in most cases it was prescribed

because of RTV intolerance, and the presence of metabolic alterations or liver disease did not influence the choice of boosted formulations. After a mean follow-up of 23.9 months, the proportions of patients still being treated were similar in the two groups. There was no noteworthy difference in the incidence of virological failure or poor compliance. The only difference emerging from the results was the incidence of AEs. As expected, hyperbilirubinaemia and hyperlipidaemia were more frequent with boosted ATV. Co-administration of ATV and TDF is currently not recommended without RTV, as the ATV plasma concentration is substantially reduced in combination with TDF. Surprisingly, no real difference Wnt inhibitor in virological outcomes emerged between the two groups when TDF was present in the backbone therapy with another NRTI. No differences in CD4 cell count, HIV viral load or clinical worsening were noted during treatment. It is important to bear in mind that the study population had been undergoing HAART for a long period, although with no major differences between the two groups. In our opinion, the significant differences between

the two groups at baseline are not relevant for the evaluation of efficacy. The CD4 cell count was lower in the unboosted ATV group at baseline, but rose during follow-up, SCH772984 nmr to give similar values in the two groups, indicating a good outcome in terms of immune reconstitution. Efficacy results were not consistent with the findings of the CARE Study, which reported respectively 52.9% and 35.6% of boosted and unboosted ATV patients with undetectable viral load at week 48. This is quite likely to have been attributable to the fact that all patients enrolled in the CARE Study Early Access Programme (EAP) had detectable viral load at baseline because SPTBN5 of multidrug resistance, and because no other

therapeutic options were available. These patients’ low mean CD4 count at baseline confirmed their worse clinical stage: 253 cells/μL in the boosted ATV group and 230 cells/μL in the unboosted ATV group compared with 400 and 315 cells/μL, respectively, in our study. Only 30% of the patients in our series switched to ATV because of virological failure: although no data were available on HIV mutations, most of them switched to ATV to simplify therapy or for therapy-related toxicity; thus it is possible that this population had a better resistance profile. HCV co-infection was significantly more frequent in patients receiving unboosted ATV, so presumably this risk factor influenced the choice of the boosted formulation. The number of patients who interrupted ATV because of grade 3–4 hyperbilirubinaemia was low in both groups and there were no significant differences in the incidence of hepatotoxicity, suggesting good liver safety for both formulations.

gambiae. Cry2Aa is a rare insecticidal protein with dual activity towards lepidopteran (moths and butterflies) (Crickmore et al., 1998) and dipteran (mosquitoes) insects (Widner & Whiteley, 1989). Reported dipteran targets of Cry2Aa include Aedes aegypti and Anopheles gambiae,

which are potential mosquito vectors of yellow fever and malaria, respectively. Although Cry2Aa and Cry2Ab display 87% structural conservation, Cry2Ab has been reported as demonstrating only lepidopteran activity (Hofte & Whiteley, 1989; Widner & Whiteley, 1989; Dankocsik et al., 1990; Morse et al., 2001). Previous attempts were made to introduce mosquitocidal activity against Ae. aegypti through chimeric-scanning mutagenesis of Cry2Ab for Cry2Aa residues 307–382 (Liang & Dean, 1994). Domain II of Cry2Aa protein is comprised of the lepidopteran- (L) AZD1152-HQPA ic50 and dipteran (D)-specific regions. Ku 0059436 Residues 341–412 are described as the L block, while the D block consists of residues 307–340 (Widner & Whiteley, 1990). Of 106 residues, only 23 differ between Cry2Aa and Cry2Ab, which are putatively responsible for the differential specificity displayed by the Cry2A toxins.

Only nine residues, located within the D block, confer specificity to dipteran insects. An epitope was proposed for Cry2Aa toxin binding to the receptor (Morse et al., 2001). Sequence alignment of cry2Aa and cry2Ab DNA was performed with clustalw2 internet-based software (http://www.ebi.ac.uk/Tools/msa/clustalw2/). To generate a model for Cry2Ab, the following programs were utilized: Cyclic nucleotide phosphodiesterase (i) internet-based software swiss-model (http://swissmodel.expasy.org/); (ii) pymol viewer v0.98 (DeLano Scientific LLC, 2005). fasta protein sequences of

Cry2Aa and Cry2Ab were entered into swiss-model Workspace Modelling-Automated Mode. A work unit with a modelled tertiary structure for Cry2Ab was generated based on the template PDB file 1i5pA. Pdb file of Cry2Ab model was downloaded and viewed with pymol viewer (Fig. 1). DEC297 strain with the cry2Ab gene was from our laboratory stocks, which was originally obtained from Dr Bill Donovan (Ecogen, Inc.) as E67219 (HD73-26 cry−), containing plasmid pEG259 (Dankocsik et al., 1990). Primers (Sigma) were designed (2Ab_startNdeIFwd: CCCTGGCATATGAGGAGGAATTTTATATGAA TAG & 2Ab_endXhoIRev: CCCGAACTCGAGGAATAAAAATAAAGAGG TTGCCTC), and cry2Ab was cloned out of DEC297. Clontech In-fusion™ method was used for cloning work. Clontech software was used to design In-fusion primers (Sigma) (2Ab_startNdeIFwd infusion1: AAGGAGATATACATATGA GGAGGAATTTTATATGAATAG & 2Ab_endXhoIRev infusion2: GGTGGTGGTGCTCGAGGAATAAAAAT AAAGAGGTTGCCTC). Primers (Sigma) were designed (2Ab_startNdeIFwd: CCCTGGCATATGAGGAGGAATTTTATATGAA TAG & 2Ab_endXhoIRev: CCCGAACTCGAGGAATAAAAATAAAGAGGTTGCCTC) and cry2Ab was cloned out of pNN101 in Bacillus thuringiensis (Dankocsik et al., 1990). Clontech In-fusion™ method was used for cloning work.

Phylogenetic analyses of eukaryotic SCP-x thiolase domains reveal that they are related to putative thiolases encoded in proteobacterial genomes (Peretóet al., 2005). Based on the phenotype of the skt-mutant strains G12 and Chol1-KO[skt] and on the similarities to the SCP-x thiolase domain, we conclude that the gene skt encodes a β-ketothiolase that catalyzes the thiolytic release of acetyl-CoA from the CoA-ester of the so far presumptive 7,12-dihydroxy-3,22-dioxo-1,4-diene-24-oate (V). The reaction products would be DHOPDC-CoA (VI), which has been detected in cell extracts of strain Chol1

previously (Birkenmaier et al., 2007), and acetyl-CoA. As the gene product of skt and its orthologs in the other cholate-degrading bacteria mainly show similarities to the SCP-x thiolase domain only and not to the SCP-2 domain of SCP-x, the annotation of these putative proteins as nonspecific lipid transfer proteins CDK inhibitor is misleading. However, Skt and its orthologs have a highly conserved motif at their C-terminus that is very similar PF-562271 to two short motifs

within the sterol-binding SCP-2 domain of the human SCP-x (Fig. 2), suggesting that this region of the bacterial proteins might be involved in interacting with the steroid skeleton of cholate. Regarding the function of Skt, it appeared surprising that DHOCTO was the major accumulating product because one would rather expect 7,12-dihydroxy-3,22-dioxo-1,4-diene-24-oate (DHDODO), the presumptive hydrolysis product of CoA-ester V, to accumulate as a dead-end metabolite. DHDODO is a β-ketoacid, which is prone to spontaneous decarboxylation. However,

we did not detect DHDODO or a presumptive decarboxylation product in our analyses. Thus, the fact that DHOCTO was the major accumulating compound suggests that blocking β-oxidation at the last step causes a negative feedback inhibition on the previous enzymatic steps. As a consequence, the CoA-esters of DHOCTO and THOCDO are hydrolyzed and the free bile salts are released. In our earlier study on the transposon mutant strain R1, we had never detected DHOCTO or THOCDO in culture supernatants (Birkenmaier et al., 2007). This indicates that the conversion of Δ1,4-3-ketocholyl-CoA (II) to DHOPDC-CoA (VI) may proceed in a tightly controlled canalized process without Orotic acid a significant release of degradation intermediates. In agreement with this hypothesis, it is also believed that β-oxidation of fatty acids occurs by substrate channelling in multienzyme complexes (Kunau et al., 1995; Peretóet al., 2005). Our study is a further step towards the verification of the pathway for the β-oxidation of the acyl side chain of cholate by strain Chol1. To elucidate this reaction sequence further, biochemical investigations regarding the formation and metabolism of the respective CoA-esters of DHOCTO and THOCDO are under way in our laboratory. We have now identified two genes, acad and skt, that encode proteins required for this part of cholate degradation.

The reaction was loaded onto a 12.5% SDS-PAGE gel, which was autoradiographed and analyzed by BAS1800 (Fuji film). For Western blot analysis, the cytoplasmic domain of BtkB was incubated with 0.1 mM ATP, 1 mM DTT, and 5 mM MgCl2 at 37 °C for 1 h. Also, ATPase activity was performed in 20 μL of 40 mM Tris–HCl buffer (pH 7.0), 1 mM DTT, 5 mM MgCl2, 1 mM ATP, and 2 μg BtkB at 37 °C for 60 min. Released phosphate was measured with the malachite green reagent (Enzo life sciences). Myxococcus xanthus wild-type and btkB mutant cells were grown in CYE medium and harvested in the exponential growth

phase and stationary phase. Also, developmental cells were prepared on CF agar plates or CYE medium containing 0.5 M glycerol. Approximately 2 × 107 cells were dissolved in SDS sample buffer, and denatured Decitabine proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE). Proteins were then transferred to PVDF membranes for Western blotting. The membranes were incubated with a horseradish peroxidase–conjugated antiphosphotyrosine PY20 (Santa Cruz Biotechnology). Blots were developed with ECL reagent (GE Healthcare). Total RNA was isolated from exponential and stationary phase cells and during cell development at 24, 48, and 72 h and then treated with DNase (Promega). After inactivation of DNase, cDNA was synthesized from the RNA samples (each 0.8 μg) using PrimeScript II RTase (Takara Bio Inc.) and random

hexamers, and PCR was performed with Kapa SYBR Fast qPCR master mix (KAPABiosystems), primers (RTbtkBN and RTbtkBC, Table S1), and the synthesized cDNA using the ABI 7300 real-time cycler. The mRNA levels of a downstream gene (MXAN_1029) were also determined INK128 by qRT-PCR analysis using the primers (RT1029N and RT1029C, Table S1). A control without reverse transcriptase was performed to detect residual contaminating genomic DNA. Exponential phase cells (8 × 108 cells mL−1) in CYE medium were used for the assays. Cells were harvested, washed, and resuspended at approximately 5 × 108 cells mL−1 in TM buffer. A total Teicoplanin of 360 μL of the cell

suspension was mixed with 40 μL dye stock solution (150 μg mL−1 Congo red and 100 μg mL−1 trypan blue). The assay was performed as previously described (Black & Yang, 2004). Cells grown in CYE medium were harvested in the exponential growth phase and stationary phase, washed three times with distilled water, and then sonicated without glass beads three times for 1 min each. Cells were also starved on CF agar and harvested at 48 and 96 h. The cells were sonicated with glass beads five times for 1 min each. The supernatant and pellet were separated by centrifugation three times at 10 000 g for 10 min. The pellet was washed three times with distilled water. The sugar contents of the supernatant and pellet suspension were determined at 490 nm by the phenol–sulfuric acid method, with glucose as the standard (Dubois et al., 1956). BtkB consists of 710 amino acid residues with a calculated molecular mass of 78.4 kDa.

1A). Increased miR-146a expression was also observed in human TLE HS specimens compared with control hippocampus (Fig. 1B). In both rat and human tissue the miR-146a expression was normalized to that of the U6B small nuclear RNA gene (rnu6b). To determine the temporal–spatial expression and cellular distribution of miR-146a, we performed in situ hybridization using LNA- and 2′OMe RNA-modified oligonucleotides in tissue samples of control rats and rats that were killed at different time points after SE (1 day, 1 week and 3–4 months post-SE). In control

hippocampus miR-146a was confined to neuronal cells, including pyramidal cells of CA1 and CA3 regions, as well as granule cells GW572016 and hilar neurons of the DG (Fig. 2A, C, E and G). No detectable staining was observed in resting glial cells. At 1 day post-SE, miR-146a showed a similar pattern as control hippocampus, with predominant neuronal staining; occasionally expression was observed in

cells with glial appearance in the areas of neuronal damage (CA1, CA3, hilus; not shown). At 1 week post-SE (Fig. 2B, D, F and H–J), prominent upregulation of miR-146a expression Temozolomide purchase was detected within the different hippocampal regions in glial cells. Strong and diffuse glial miR-146a expression was particularly observed in the inner molecular layer of the DG and in the hilar region (Fig. 2I). Pyramidal neurons of CA1 and CA3 regions and granule cells of DG also displayed strong miR-146a expression. In the chronic phase (3–4 months post-SE) the hippocampus showed a pattern similar to that observed at 1 week post-SE, with both neuronal and glial expression, which was mainly localized in regions of prominent gliosis, such as the hilar region (Fig. 2J). Co-localization studies indicated that miR-146a was induced in glial cells in this region and that expression was confined to astrocytes, whereas no detectable expression was observed in lectin-positive cells of the microglial/macrophage lineage (Fig. 2J and inserts a/b). The percentage of cells

positive for miR-146a and co-expressing GFAP was quantified in both CA3 and DG at 1 week post SE (76 ± 2, CA3; 70 ± 4, Niclosamide DG). No co-localization with lectin was observed in both regions. The cellular distribution of miR-146a in human hippocampus was investigated using in situ hybridization. Differences in the expression level, as well as in the cell-specific distribution, were found in specimens from patients with HS (Fig. 3). In control hippocampus, we observed miR-146a expression in neuronal cells, including pyramidal cells of CA1 and CA3 regions, as well as granule cells and hilar neurons of the DG (Fig. 3A, C and E). No detectable staining was observed in resting glial cells. In all the HS specimens examined, miR-146a expression was increased in the different subfields of the hippocampus; abundant miR-146a-positive glial cells with typical astroglia morphology were observed in the areas of prominent gliosis (Fig. 3B, D and F).

Nevertheless, other types of SOD have been shown to be important in some plant–pathogen interactions, as the soft-rot pathogen Dickeya dadantii (Erwinia chrysanthemi) 3937 has been shown to require Mn-SOD activity for the successful maceration of Saintpaulia ionantha leaves, although interestingly the Mn-SOD mutant retained the ability

to macerate potato tubers (Santos et al., 2001). It seems likely that the relative importance of different antioxidant enzymes varies according to environmental factors such as pH and metal ion availability. Possession of multiple antioxidant enzymes that vary in terms of substrate, cofactor and optimal environmental conditions enables plant pathogenic Pseudomonas to colonize a range of different environments and to adapt to the changing environment present in healthy and diseased plant tissue. One environment that is less frequently considered in the context of plant pathogenesis is the environment encountered find more during

dispersal. P. syringae and related pathogens are commonly dispersed in aerosols, which carry an inherent risk of dessication and subsequent accumulation of ROS within the cell (Cox, 1989). By demonstrating that exogenous catalase can significantly enhance the ‘resuscitation’ Ulixertinib mouse of airborne bacteria cells, including P. syringae cells, Marthi et al. (1991) have shown that antioxidant enzymes are likely to be important not only during pathogenesis Thymidine kinase but also during the dispersal of pathogenic bacteria. Another

important factor in a bacterial pathogen’s ability to withstand the oxidative burst is its coating of extracellular polysaccharides (EPS), which act to protect the bacterium against oxidative stress. Examples of EPS found in Pseudomonas species include alginate and levan (Fett & Dunn, 1989; Fett et al., 1989; Chang et al., 2007). EPS can be very complex and can differ greatly between related pathogens, which may be related to their role in bacteria–host interactions, and the pathogen’s need to escape detection (de Pinto et al., 2003; Silipo et al., 2010). In P. syringae pv. syringae, EPS has been shown to have a role in leaf colonization and symptom development (Yu et al., 1999); the EPS of P. syringae and P. aeruginosa are known to be upregulated by exposure to ROS (Keith & Bender, 1999). Keith et al. (2003) studied the expression of the algD gene, involved in alginate production, in planta, and found evidence that this gene is upregulated in response to ROS produced by the plant and that this induction of alginate production occurs in both compatible and incompatible plant–pathogen interactions (Keith et al., 2003). In P. syringae pv. syringae B728a, EPS production has been shown to be regulated via quorum sensing (Quiñones et al., 2005). Mutants impaired in quorum sensing lack alginate and have increased sensitivity to ROS, providing further evidence for the importance of EPS in withstanding oxidative stress (Quiñones et al., 2005).

Nevertheless, other types of SOD have been shown to be important in some plant–pathogen interactions, as the soft-rot pathogen Dickeya dadantii (Erwinia chrysanthemi) 3937 has been shown to require Mn-SOD activity for the successful maceration of Saintpaulia ionantha leaves, although interestingly the Mn-SOD mutant retained the ability

to macerate potato tubers (Santos et al., 2001). It seems likely that the relative importance of different antioxidant enzymes varies according to environmental factors such as pH and metal ion availability. Possession of multiple antioxidant enzymes that vary in terms of substrate, cofactor and optimal environmental conditions enables plant pathogenic Pseudomonas to colonize a range of different environments and to adapt to the changing environment present in healthy and diseased plant tissue. One environment that is less frequently considered in the context of plant pathogenesis is the environment encountered buy PD0325901 during

dispersal. P. syringae and related pathogens are commonly dispersed in aerosols, which carry an inherent risk of dessication and subsequent accumulation of ROS within the cell (Cox, 1989). By demonstrating that exogenous catalase can significantly enhance the ‘resuscitation’ HM781-36B mouse of airborne bacteria cells, including P. syringae cells, Marthi et al. (1991) have shown that antioxidant enzymes are likely to be important not only during pathogenesis many but also during the dispersal of pathogenic bacteria. Another

important factor in a bacterial pathogen’s ability to withstand the oxidative burst is its coating of extracellular polysaccharides (EPS), which act to protect the bacterium against oxidative stress. Examples of EPS found in Pseudomonas species include alginate and levan (Fett & Dunn, 1989; Fett et al., 1989; Chang et al., 2007). EPS can be very complex and can differ greatly between related pathogens, which may be related to their role in bacteria–host interactions, and the pathogen’s need to escape detection (de Pinto et al., 2003; Silipo et al., 2010). In P. syringae pv. syringae, EPS has been shown to have a role in leaf colonization and symptom development (Yu et al., 1999); the EPS of P. syringae and P. aeruginosa are known to be upregulated by exposure to ROS (Keith & Bender, 1999). Keith et al. (2003) studied the expression of the algD gene, involved in alginate production, in planta, and found evidence that this gene is upregulated in response to ROS produced by the plant and that this induction of alginate production occurs in both compatible and incompatible plant–pathogen interactions (Keith et al., 2003). In P. syringae pv. syringae B728a, EPS production has been shown to be regulated via quorum sensing (Quiñones et al., 2005). Mutants impaired in quorum sensing lack alginate and have increased sensitivity to ROS, providing further evidence for the importance of EPS in withstanding oxidative stress (Quiñones et al., 2005).