Plating medium included 1.2% wt/vol Noble agar (final concentration) (Fisher Scientific) and

plates were incubated at 30°C, inverted and sealed with parafilm. Kanamycin, when needed, was added to the medium at a final concentration of 20 μg/mL. Escherichia coli strains TOP10 (Invitrogen, Carlsbad, CA) or NEB5α (New England Biolabs, Ipswich, MA) were used for all plasmid manipulations. Construction of L. Anlotinib biflexa mutant strains Transformation of L. biflexa followed the protocol of Louvel and Picardeau [43]. L. biflexa deletion mutants were constructed by allelic exchange with the kanamycin-resistance marker driven by the borrelial flgB promoter [13]. Proof-reading polymerases Vent (New England BioLabs) or the Expand Long Template PCR System (Roche Applied Science, Indianapolis, IN) were used for learn more fragment amplification according to the manufacturer’s recommendations and the fidelity of amplification was confirmed by double-stranded sequencing. Primers used for plasmid construction are shown in Table 1. The region encompassing the batABD locus and surrounding sequences was PCR-amplified using primers Lb.htpG.F

and Lb.II0014.RC, yielding a 6,113 bp fragment that was Selleckchem Trichostatin A then cloned into pCR-XL-TOPO (Invitrogen). Inverse PCR was used to delete the batABD genes using primers batKO.F.NheI and batAKO.RC.NheI, which incorporated NheI restriction enzyme sites for self-ligation of the resulting product. Rucaparib datasheet NheI restriction enzyme sites were also incorporated onto the kanamycin–resistance cassette by PCR amplification using primers Pflg.NheI.F and Tkan.NheI.RC. Both the pTopoXL::ΔbatABD and the flgB P -kan cassette were digested with NheI and ligated together to create the allelic exchange vector pΔABD1-kn. A similar strategy was

used to create the allelic exchange construct for batA (pΔbatA-kn) using primers batB.seq1.F and Lb.II0013/14.PCR1.RC to amplify a 2,565 bp fragment containing batA. Inverse PCR with primers batAKO.F.NheI and batAKO.RC.NheI were used to delete the coding region of batA and engineer the restriction enzyme sites needed to insert the kanamycin-resistance cassette. The deletions of the respective bat genes in the mutant strains of L. biflexa were confirmed by Southern blot analysis of total genomic DNA digested with the restriction enzymes NdeI and PstI, as previously described [44, 45]. Primers used for probe amplification are listed in Table 1. Table 1 Oligonucleotides used in this study Oligonucleotide Sequence (5′– 3′) Function Lb.htpG.F GTCTACATTGAGATGGATGTGG Amplification of batABD + flanking sequences Lb.II0014.RC CAGACCAATTACTCAAATGC Amplification of batABD + flanking sequences batB.seq1.F CAGCGATGGACTCTAGAAAATC Amplification of batA + flanking sequences Lb.II0013/14.PCR1.RC CTGTTGTTATCTTCGCTTCAC Amplification of batA + flanking sequences batAKO.RC.NheI a gctagcGTTAGGTTATAAAATCCTTTTTG Construction of allelic-exchange plasmids batKO.F.