Nymphs and adults were dissected, the salivary glands collected and immersed in a cell lysis solution for subsequent DNA extraction. DNA was extracted from cervid blood samples (300 μL) with the aid of a Wizard® Genomic DNA Purification Kit (Promega, Madison, BI 6727 ic50 WI, USA) employed according to the manufacturer’s instructions. In order to extract DNA from tick salivary glands, the same commercial kit was used following the manufacturer’s instructions designated for the extraction

of DNA from tissue cultures. The nPCR assay of genomic DNA involved two separate amplification reactions. The first reaction was carried out using the primers RIB-19 (5′CGGGATCCAACCTGGTTGATCCTGC3′) and RIB-20 (5′CCGAATTCCTTGTTACGACTTCTC3′) that are specific

for a 1700 bp segment of the 18S rRNA gene from find more Babesia and Theileria spp. ( Zahler et al., 2000). The reaction mixture comprised 1.2 μL of dNTPs (0.2 mM), 0.15 μL of Taq polymerase (0.05 U), 1.5 μL which buffer (1×), 0.6 μL of a solution containing the mixed primers (10 μM) and sufficient sterile ultra-pure water to give a final volume of 15 μL. A 1.5 μL aliquot of the DNA template was added to the reaction mixture, and amplification was performed using an Eppendorf (São Paulo, SP, Brazil) Mastercycler® thermocycler programmed as follows: 94 °C for 5 min (initial denaturation step), 30 cycles each comprising 92 °C for 1 min (denaturation), 54 °C for 1 min (annealing) and 72 °C for 2 min (extension), and a final extension step at 72 °C for 8 min. Following amplification, reaction mixtures were maintained at 12 °C. PCR amplicons were separated by electrophoresis on 1% agarose gel (40 min, 100 V), stained with ethidium bromide and visualised under ultraviolet light. The second reaction was carried out using primers BabRumF (5′ACCTCACCAGGTCCAGACAG3′) and BabRumR (5′GTACAAAGGGCAGGGACGTA3′) that were designed to amplify a common 420 bp Babesia 18S rRNA fragment identified by aligning sequences from Babesia spp. available at GenBank (http://www.ncbi.nlm.nih.gov), Cytidine deaminase namely, B. bigemina (X59607), B. odocoilei (U16369), Babesia

divergens (U07885) and B. bovis (L31922). The reaction mixture comprised 2.0 μL of dNTPs (0.2 mM), 0.25 μL of Taq polymerase (0.05 U), 2.5 μL which buffer (1×), 1.0 μL of a solution containing the mixed primers (10 μM) and sufficient sterile ultra-pure water to give a final volume of 25 μL. An aliquot (2.5 μL) of amplicon obtained in the first reaction were added to the reaction mixture and amplification was carried out under the conditions described above. Products were separated by electrophoresis and visualised as described above, and subsequently purified with the aid of QIAquick PCR Purification Kit (Qiagen Biotecnologia Brasil, São Paulo, SP, Brazil) used according to the recommendations of the manufacturer.