Chromogen development was mediated by the

addition of 100 ul of freshly prepared substrate solution (o-phenylenediamine-dihydrochloride; Sigma). The reaction was stopped by adding see more 0.1 N sulfuric acid, and the optical density at 490 nm was recorded. The detection limit was determined by the optical density value that gave a signal-to-noise ratio of 3. Dot ELISA The dot ELISA rapid test kit with the two complementary Mabs was manufactured by Wantai biotechnology company, China [14]. The dot ELISA test was performed following the manufacturer’s protocol. Briefly, 200 ul of samples was lysed with 400 ul lysis buffer and loaded on a filter device. The filtrated samples went through the membrane coated with Mabs. Following washing with wash buffer of three times, the substrate reagent was added

on the membrane and the signal was developed. Results were read within 5 minutes after adding stop solution. Preparation of tracheal swab samples 200 samples of tracheal swab were collected from https://www.selleckchem.com/products/pi3k-hdac-inhibitor-i.html fresh avian species from Bogor and Makassar (South Sulawesi) to detect any possible existence of H5 avian influenza virus. A serial dilution (multiple of 10) was performed on the virus of subtype H5N1 with predetermined titer level. The multiplication level of the dilution started initially at 10-1 and gradually increased to 10-4. The dissolved viruses were tested by dot ELISA kit to determine the capability of detecting the most dissolved virus in swabs. The experiment has been repeated three Nitroxoline times. Using Reed and Muench mathematical technique, the infectivity titer of each Tideglusib mw sample was expressed as EID50/ml. RT-PCR Extraction of total RNA was performed following manufacturers’ protocol from QIAamp Viral RNA Mini Kit (Qiagen, Germany) using all necessary safety precautions. The

resultant RNA was dissolved in 20 ul of RNase-free water. Three PCRs were performed using two H5 primer pairs and HA2 specific primers individually. One pair of H5 primers consist of primers J3 and B2a as described previously [27]. The primer pair is as follows: J3: GAT AAA TTC TAG CAT GCC ATT CC B2a: TTT TGT CAA TGA TTG AGT TGA CCT TAT TGG. The second H5 specific primer pair was forward primer: 5′-TCAGATTTGCATTGGTTACC-3′ and reverse primer: 5′- ACTATGTAAGACCATTCCGG3′). HA2 primers were: forward primer: 5′-ACTATGAAGAATGAAACACCT-3′ and reverse primer: 5′ GCAATGAAATTTCCATTACTCTC-3′). One step RT-PCR cycling conditions were 60°C for 1 min, 42°C for 10 min, 50°C for 30 min, and 94°C for 15 min followed by 35 cycles of 94°C for 30 sec, 50°C for 30 sec, and 72°C for 1 min and lastly followed by 72°C for 10 min. The PCR products were resolved in 1.2% agarose gels with the sizes of around 312 bp- 456 bp. PCR products were further sequenced to confirm the identity of the products. Acknowledgements This work was supported by Temasek Life Sciences Laboratory, Singapore.